580: Random Topic Generator

Here is a random subject generator; a tool for bloggers utterly devoid of inspiration and internal thought process. It's been almost twenty four hours since the last time I was called upon to write words, on a piece of non-existent paper, and during that time I've slept, been to work, spoken to various people about various things, shopped for spectacle frames, eaten Greek lamb and lentils in Manchester Arndale Market food court, ridden the tram, had a nap, watched a pretty good music video that features a friend's severed head mounted on a wall, made and eaten a delicious shepherds' pie, and here we all are. Also during that time my friend and godson have come to stay with us from Tanzania.

Despite all this activity I am reduced to clawing helplessly at the dregs of the random subject generator. How random it is, I do not know, since I have only seen, so far, the first subject it has generated. It is possible, and indeed likely, that it only actually has five subjects which it serves up cyclically in order to every helplessly empty-minded sucker who sucks. And here I am, helpless, empty-headed, and sucking, and the subject served to me is The autonomy of nude art. What this piece of code doesn't know is that I have already done my blog about nude art, here: My "Private" Library. What it also doesn't know is that I finished my art degree about seven years ago, and thus have no interest nor reason in unpicking the meaning behind pretentious phrases like The autonomy of nude art. There's just no need. No need at all.

Your favourite novels; Simple origami; Religions – ranked by age; A word that means something to you; Where to rent good snowboards; Chocolate, good or bad for you?; Nutrition for young kids; Your worst enemy; Your favourite dinosaur; The birth of Jazz; George Washington in the Revolutionary War; Cities to visit; DNA notations; A movie poster that has affected you; Music and mathematics; How to cut your spending. Those are the topics. There may be others but we haven't got all day. I can't tackle all of those so I'm just going to throw darts at the screen and wherever they stick, that subject, by dint of blind chance, becomes worthy of a sentence or two.

DNA Notations:

CTACGATCGATCGTACTGATCGTAGCTAGCTAGTCGATCGATCGTAGTCGATGCTACGTAGCTAATGACGATGCTATGCATAGTCGTACGTACGTGTGTGTTTAATTATATCGATCGATCGATCGATGCGCGCTACGTACGATCGATGCTAGCTAGCTAGCTAGCTGATCGATCGTAGTCGATCGTATATGCGGTCAGCGATGTATCGGGCGCGGGGGGCGCGAGATAGTATGCATGTAGCTTAGGAC

Cities to visit:

All of them, from Aalborg to Żywiec.

Where to rent good snowboards:
I don't know. Halfords, or somewhere.

A word that means something to you:
Word.

How to cut your spending:
Stop saying, "oh my god, I need those shoes, I don't know when I will wear them, but they are just so cute. Should I get them? I'm getting them."

Well, that went well.  More of the same tomorrow?